Stem-loop sequence dme-mir-996

AccessionMI0005857 (change log)
DescriptionDrosophila melanogaster miR-996 stem-loop
Gene family MIPF0000449; mir-996
Literature search

4 open access papers mention dme-mir-996
(119 sentences)

Stem-loop
   u       u    u  c     a      -      g     ugguuca 
5'  cugacuc auuu gu ggcga caugga ucuagu cacgg       u
    ||||||| |||| || ||||| |||||| |||||| |||||        
3'  gacuggg ugaa ua cugcu guacuu agauca gugcu       g
   -       u    u  u     c      u      -     ugaauua 
Get sequence
Deep sequencing
723240 reads, 1.76e+04 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 29217184-29217280 [+]
sense
FBtr0085391 ; CR31044-RA; exon 1
FBtr0303426 ; CR31044-RB; intron 2
FBtr0303427 ; CR31044-RC; exon 2
Clustered miRNAs
< 10kb from dme-mir-996
dme-mir-279chr3R: 29215585-29215684 [+]
dme-mir-996chr3R: 29217184-29217280 [+]
Database links

Mature sequence dme-miR-996-5p

Accession MIMAT0020895
Sequence

19 - 

gcgaacauggaucuagugcacg

 - 40

Get sequence
Deep sequencing41672 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-996-3p

Accession MIMAT0005515
Previous IDsdme-miR-996
Sequence

61 - 

ugacuagauuucaugcucgucu

 - 82

Get sequence
Deep sequencing681390 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).