Stem-loop sequence dme-mir-995

Accession MI0005856
Description Drosophila melanogaster miR-995 stem-loop
Gene family MIPF0000895; mir-995
Stem-loop 
--ca    c   c  c    c           ga      cc   u 
    ccug acc cg agcc gaauuaugugg  gcugcg  guu c
    |||| ||| || |||| |||||||||||  ||||||  ||| c
    ggac ugg gc ucgg cuuaguacacc  cgaugc  uaa g
uaua    a   u  u    -           -a      -c   u
Get sequence
Deep sequencing
125560 reads, 50 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3R: 16561645-16561734 [+]
sense
FBtr0300447 ; cdc2c-RC; intron 1
FBtr0083921 ; cdc2c-RA; intron 1
FBtr0083922 ; cdc2c-RB; intron 1
FBtr0300447 ; cdc2c-RC; intron 1
FBtr0083921 ; cdc2c-RA; intron 1
FBtr0083922 ; cdc2c-RB; intron 1
FBtr0300447 ; cdc2c-RC; intron 1
FBtr0083921 ; cdc2c-RA; intron 1
FBtr0083922 ; cdc2c-RB; intron 1

Mature sequence dme-miR-995-5p

Accession MIMAT0010206
Previous IDs dme-miR-995*
Sequence

17 -  

cccgaauuaugugggagcugcg

 - 38

Get sequence
Deep sequencing 5617 reads, 49 experiments
Evidence experimental; 454 [3]
Predicted targets

Mature sequence dme-miR-995-3p

Accession MIMAT0005514
Previous IDs dme-miR-995
Sequence

55 -  

uagcaccacaugauucggcuu

 - 75

Get sequence
Deep sequencing 119934 reads, 50 experiments
Evidence experimental; 454 [1-3], Solexa [2]
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).
3
PMID:18463636 "Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells" Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, Siomi H Nature. 453:793-797(2008).