Stem-loop sequence dme-mir-994

AccessionMI0005855 (change log)
DescriptionDrosophila melanogaster miR-994 stem-loop
Gene family MIPF0001045; mir-994
Literature search

2 open access papers mention dme-mir-994
(2 sentences)

Stem-loop
   --uauc            -           c     uuuacccaag 
5'       gaguuaucuaag gaaauaguagc gugau          a
         |||||||||||| ||||||||||| |||||           
3'       cucgauagauuu cuuugucguug cacua          a
   uguuuu            u           a     uacacuuuuu 
Get sequence
Deep sequencing
484462 reads, 3.09e+03 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 10408137-10408227 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-994
dme-mir-994chr3R: 10408137-10408227 [+]
dme-mir-318chr3R: 10408302-10408369 [+]
Database links

Mature sequence dme-miR-994-5p

Accession MIMAT0005513
Previous IDsdme-miR-994
Sequence

12 - 

cuaaggaaauaguagccgugau

 - 33

Get sequence
Deep sequencing480735 reads, 46 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-994-3p

Accession MIMAT0020894
Sequence

58 - 

cacaguugcuguuucuuuuagau

 - 80

Get sequence
Deep sequencing3702 reads, 38 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).