Stem-loop sequence dme-mir-137

AccessionMI0005849 (change log)
DescriptionDrosophila melanogaster miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

9 open access papers mention dme-mir-137
(55 sentences)

Stem-loop
   ---c      caa  gc -        g    u   u     --c  a 
5'     aaucuc   ug  c acguguau cucg agc auaac   ug a
       ||||||   ||  | |||||||| |||| ||| |||||   || a
3'     uuagag   ac  g ugcacaua gagu ucg uauug   ac u
   uugu      -cc  uu a        a    -   u     uaa  c 
Get sequence
Deep sequencing
4427 reads, 40.4 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 16065254-16065344 [-]
intergenic
Database links

Mature sequence dme-miR-137-5p

Accession MIMAT0020888
Sequence

16 - 

acguguaugcucguagcuauaac

 - 38

Get sequence
Deep sequencing226 reads, 27 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-137-3p

Accession MIMAT0005507
Previous IDsdme-miR-137
Sequence

54 - 

uauugcuugagaauacacguag

 - 75

Get sequence
Deep sequencing4197 reads, 47 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).