Stem-loop sequence dme-mir-137

Accession MI0005849
Description Drosophila melanogaster miR-137 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. miR-137 has also been shown to regulate dendritic development and maturation of neurons. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---c      caa  gc -        g    u   u     --c  a 
    aaucuc   ug  c acguguau cucg agc auaac   ug a
    ||||||   ||  | |||||||| |||| ||| |||||   || a
    uuagag   ac  g ugcacaua gagu ucg uauug   ac u
uugu      -cc  uu a        a    -   u     uaa  c 
Get sequence
Deep sequencing
1975 reads, 41 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 11952759-11952849 [-]
intergenic

Mature sequence dme-miR-137-5p

Accession MIMAT0020888
Sequence

16 - 

acguguaugcucguagcuauaac

 - 38

Get sequence
Deep sequencing 75 reads, 18 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-137-3p

Accession MIMAT0005507
Previous IDs dme-miR-137
Sequence

54 - 

uauugcuugagaauacacguag

 - 75

Get sequence
Deep sequencing 1900 reads, 40 experiments
Evidence experimental; 454 [1-2], Solexa [2]
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).