Stem-loop sequence dme-mir-988

AccessionMI0005847 (change log)
DescriptionDrosophila melanogaster miR-988 stem-loop
Gene family MIPF0000724; mir-988
Literature search

1 open access papers mention dme-mir-988
(6 sentences)

Stem-loop
   gacg    uaccggg      g      u a          ---a     aug 
5'     gcgg       cauuuu ggugug g uuuguagcaa    gugau   u
       ||||       |||||| |||||| | ||||||||||    |||||   a
3'     cguc       guagaa ccgcac c aaacguuguu    uacua   u
   --ag    -----ua      a      u c          cccc     guu 
Get sequence
Deep sequencing
110953 reads, 4.38e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 12158872-12158970 [-]
sense
FBtr0088016 ; Prp8-RA; intron 9
Database links

Mature sequence dme-miR-988-5p

Accession MIMAT0020886
Sequence

26 - 

gugugauuuguagcaaagugau

 - 47

Get sequence
Deep sequencing13064 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-988-3p

Accession MIMAT0005505
Previous IDsdme-miR-988
Sequence

62 - 

ccccuuguugcaaaccucacgc

 - 83

Get sequence
Deep sequencing97842 reads, 49 experiments
Evidence experimental; 454 [1-3], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).
3
PMID:18463636 "Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells" Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, Siomi H Nature. 453:793-797(2008).