|
miRBase |
|
Stem-loop sequence dme-mir-927 |
|||||
| Accession | MI0005843 | ||||
| Description | Drosophila melanogaster miR-927 stem-loop | ||||
| Gene family | MIPF0000452; mir-927 | ||||
| Stem-loop |
--- uug u a cu a uggcau ugg c guag guuuuagaauuc acgcuuu ccg a ||| | |||| |||||||||||| ||||||| ||| acc g cauc caaagucuuagg ugcgaaa ggc c auu -ua c c uu c uuaaag |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence dme-miR-927-5p |
|
| Accession | MIMAT0005501 |
| Previous IDs | dme-miR-927 |
| Sequence |
16 - uuuagaauuccuacgcuuuacc - 37 |
| Deep sequencing | 13400 reads, 35 experiments |
| Evidence | experimental; 454 [1], Solexa [2] |
| Predicted targets |
|
Mature sequence dme-miR-927-3p |
|
| Accession | MIMAT0020882 |
| Sequence |
56 - caaagcguuuggauucugaaac - 77 |
| Deep sequencing | 620 reads, 30 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 2 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|