Stem-loop sequence dme-mir-981

AccessionMI0005838 (change log)
DescriptionDrosophila melanogaster miR-981 stem-loop
Gene family MIPF0000710; mir-981
Literature search

5 open access papers mention dme-mir-981
(5 sentences)

Stem-loop
   aaaca   u   u aagu          ua          -   uuaa 
5'      ucc cac g    cggguuucgu  gcagcgggcu guu    u
        ||| ||| |    ||||||||||  |||||||||| |||    a
3'      agg gug c    guccaaagca  uguugcuuga caa    a
   -uaaa   u   u guac          gc          a   cuua 
Get sequence
Deep sequencing
88386 reads, 1.91e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 1788861-1788957 [-]
antisense
FBtr0309966 ; CG42666-RG; intron 2
Database links

Mature sequence dme-miR-981-5p

Accession MIMAT0020878
Sequence

19 - 

cggguuucguuagcagcgggcu

 - 40

Get sequence
Deep sequencing2525 reads, 39 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-981-3p

Accession MIMAT0005497
Previous IDsdme-miR-981
Sequence

61 - 

uucguugucgacgaaaccugca

 - 82

Get sequence
Deep sequencing85861 reads, 48 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).