Stem-loop sequence dme-mir-980

AccessionMI0005837 (change log)
DescriptionDrosophila melanogaster miR-980 stem-loop
Gene family MIPF0000890; mir-980
Literature search

3 open access papers mention dme-mir-980
(161 sentences)

Stem-loop
   ---aguu          c          uu   cu       uuacuccu 
5'        gauuguaugu aguuuuucau  ggc  ggcuagc        u
          |||||||||| ||||||||||  |||  |||||||        u
3'        uuaaugugca ucgggaagug  ccg  ucgaucg        u
   cuugacg          u          uu   --       uuauaaau 
Get sequence
Deep sequencing
40355 reads, 351 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 280172-280269 [-]
antisense
FBtr0070066 ; CG3777-RB; intron 1
Database links

Mature sequence dme-miR-980-5p

Accession MIMAT0020877
Sequence

16 - 

aguuuuucauuuggccuggcuagc

 - 39

Get sequence
Deep sequencing420 reads, 38 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-980-3p

Accession MIMAT0005496
Previous IDsdme-miR-980
Sequence

61 - 

uagcugccuugugaagggcuua

 - 82

Get sequence
Deep sequencing39934 reads, 39 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).