Stem-loop sequence dme-mir-971

AccessionMI0005828 (change log)
DescriptionDrosophila melanogaster miR-971 stem-loop
Gene family MIPF0000995; mir-971
Literature search

3 open access papers mention dme-mir-971
(5 sentences)

Stem-loop
   uc  u        u            auu    u      a   -   u 
5'   cg ggcuggca cgcucgcuguaa   guaa caucaa gcg uuu c
     || |||||||| ||||||||||||   |||| |||||| ||| ||| u
3'   gc cugaccgu gugagugacauu   cauu gugguu cgc gag c
   au  -        -            cuu    -      -   c   a 
Get sequence
Deep sequencing
3531 reads, 122 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 13062072-13062167 [+]
sense
FBtr0302270 ; CG42629-RB; intron 3
Database links

Mature sequence dme-miR-971-5p

Accession MIMAT0020868
Sequence

20 - 

gcuguaaauuguaaucaucaaagc

 - 43

Get sequence
Deep sequencing302 reads, 29 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-971-3p

Accession MIMAT0005487
Previous IDsdme-miR-971
Sequence

60 - 

uugguguuacuucuuacaguga

 - 81

Get sequence
Deep sequencing3228 reads, 46 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).