Stem-loop sequence dme-mir-970

AccessionMI0005827 (change log)
DescriptionDrosophila melanogaster miR-970 stem-loop
Gene family MIPF0000700; mir-970
Literature search

6 open access papers mention dme-mir-970
(14 sentences)

Stem-loop
   gaa     u u    c    a   g        uu      cug   u 
5'    aggca c guug agcu gcg guguuuua  ugguag   uaa g
      ||||| | |||| |||| ||| ||||||||  ||||||   |||  
3'    ucugu g caau ucgg cgc cacagaau  acuauc   guu a
   gaa     u c    a    -   a        --      uaa   u 
Get sequence
Deep sequencing
116654 reads, 1.09e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 12636336-12636430 [+]
sense
FBtr0300375 ; tomosyn-RF; intron 2
FBtr0300376 ; tomosyn-RG; intron 2
FBtr0307898 ; tomosyn-RH; intron 2
FBtr0073678 ; tomosyn-RC; intron 2
FBtr0073679 ; tomosyn-RD; intron 2
FBtr0307899 ; tomosyn-RI; intron 3
FBtr0307900 ; tomosyn-RJ; intron 3
Database links

Mature sequence dme-miR-970-5p

Accession MIMAT0020867
Sequence

17 - 

agcuagcggguguuuuauuuggua

 - 40

Get sequence
Deep sequencing1066 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-970-3p

Accession MIMAT0005486
Previous IDsdme-miR-970
Sequence

61 - 

ucauaagacacacgcggcuau

 - 81

Get sequence
Deep sequencing115572 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).