Stem-loop sequence dme-mir-965

Accession MI0005821
Description Drosophila melanogaster miR-965 stem-loop
Gene family MIPF0000708; mir-965
Stem-loop 
-- a     uu    -   a          u    -         a    ugcccuu 
  g caaua  gcuc aac uuuugggggg aaaa cuguacguu uaug       c
  | |||||  |||| ||| |||||||||| |||| ||||||||| ||||       u
  c guuau  cgag uug aaaauucccc uuuu gauaugcga auac       g
aa -     --    a   -          -    c         -    uuauagu
Get sequence
Deep sequencing
56896 reads, 50 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 243035-243141 [-]
sense
FBtr0078144 ; kis-RA; intron 1
FBtr0299837 ; kis-RC; intron 1
FBtr0308253 ; kis-RD; intron 1
FBtr0308255 ; kis-RF; intron 1
FBtr0078144 ; kis-RA; intron 1
FBtr0308254 ; kis-RE; intron 1
FBtr0299837 ; kis-RC; intron 1
FBtr0308253 ; kis-RD; intron 1
FBtr0308255 ; kis-RF; intron 1
FBtr0078144 ; kis-RA; intron 1
FBtr0308254 ; kis-RE; intron 1
FBtr0299837 ; kis-RC; intron 1

Mature sequence dme-miR-965-5p

Accession MIMAT0020861
Sequence

24 -  

gggguaaaacuguacguuauaug

 - 46

Get sequence
Deep sequencing 3559 reads, 48 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-965-3p

Accession MIMAT0005480
Previous IDs dme-miR-965
Sequence

66 -  

uaagcguauagcuuuuccccuu

 - 87

Get sequence
Deep sequencing 52902 reads, 50 experiments
Evidence experimental; 454 [1-2], Solexa [2]
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).