Stem-loop sequence dme-mir-932

AccessionMI0005820 (change log)
DescriptionDrosophila melanogaster miR-932 stem-loop
Gene family MIPF0000588; mir-932
Literature search

4 open access papers mention dme-mir-932
(10 sentences)

Stem-loop
   -uu    - ug     u    u          a        u  uu 
5'    gguu u  aaguu ucaa uccguagugc uugcagug gu  c
      |||| |  ||||| |||| |||||||||| |||||||| ||   
3'    ccag a  uucaa gguu aggcgucgcg aacgucau ua  a
   cuu    c gu     c    u          -        u  uu 
Get sequence
Deep sequencing
24907 reads, 473 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 6902062-6902152 [+]
sense
FBtr0307033 ; neuroligin-RB; intron 3
FBtr0079344 ; neuroligin-RA; intron 3
Database links

Mature sequence dme-miR-932-5p

Accession MIMAT0005479
Previous IDsdme-miR-932
Sequence

16 - 

ucaauuccguagugcauugcag

 - 37

Get sequence
Deep sequencing23088 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-932-3p

Accession MIMAT0020860
Sequence

55 - 

ugcaagcgcugcggauuuggca

 - 76

Get sequence
Deep sequencing1819 reads, 41 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).