Stem-loop sequence dme-mir-964

AccessionMI0005819 (change log)
DescriptionDrosophila melanogaster miR-964 stem-loop
Gene family MIPF0000949; mir-964
Stem-loop
   caauaacauau     --   c   c             agc        uguuu 
5'            ugguc  caa uug cuuagaauagggg   uuaacuua     u
              |||||  ||| ||| |||||||||||||   ||||||||     u
3'            acuag  guu aac gaaucuugucucc   aauugaau     g
   -----------     ua   u   a             gaa        uugua 
Get sequence
Deep sequencing
2753 reads, 111 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 5642102-5642201 [+]
antisense
FBtr0079114 ; CG31646-RA; intron 3
Clustered miRNAs
< 10kb from dme-mir-964
dme-mir-959chr2L: 5640940-5641037 [+]
dme-mir-960chr2L: 5641063-5641155 [+]
dme-mir-961chr2L: 5641191-5641279 [+]
dme-mir-962chr2L: 5641298-5641389 [+]
dme-mir-963chr2L: 5641990-5642078 [+]
dme-mir-964chr2L: 5642102-5642201 [+]
Database links

Mature sequence dme-miR-964-5p

Accession MIMAT0005478
Previous IDsdme-miR-964
Sequence

26 - 

uuagaauaggggagcuuaacuu

 - 47

Get sequence
Deep sequencing2602 reads, 45 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-964-3p

Accession MIMAT0020859
Sequence

64 - 

aguuaaaagccucuguucuaag

 - 85

Get sequence
Deep sequencing107 reads, 19 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).