Stem-loop sequence dme-mir-963

AccessionMI0005818 (change log)
DescriptionDrosophila melanogaster miR-963 stem-loop
Gene family MIPF0001035; mir-963
Stem-loop
   -uua        uaa     -    a   u     u     cugua 
5'     gucuaauc   aacaa ggua aua caggu guuuc     u
       ||||||||   ||||| |||| ||| ||||| |||||      
3'     cagguuag   uuguu ccau uau gucua caaag     u
   aaaa        -cc     u    a   -     -     cuagc 
Get sequence
Deep sequencing
1877 reads, 113 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 5641990-5642078 [+]
antisense
FBtr0079114 ; CG31646-RA; intron 3
Clustered miRNAs
< 10kb from dme-mir-963
dme-mir-959chr2L: 5640940-5641037 [+]
dme-mir-960chr2L: 5641063-5641155 [+]
dme-mir-961chr2L: 5641191-5641279 [+]
dme-mir-962chr2L: 5641298-5641389 [+]
dme-mir-963chr2L: 5641990-5642078 [+]
dme-mir-964chr2L: 5642102-5642201 [+]
Database links

Mature sequence dme-miR-963-5p

Accession MIMAT0005477
Previous IDsdme-miR-963
Sequence

16 - 

acaagguaaauaucagguuguuuc

 - 39

Get sequence
Deep sequencing1651 reads, 45 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-963-3p

Accession MIMAT0020858
Sequence

54 - 

aacaucuguauauaccuuuguu

 - 75

Get sequence
Deep sequencing226 reads, 29 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).