Stem-loop sequence dme-mir-961

AccessionMI0005816 (change log)
DescriptionDrosophila melanogaster miR-961 stem-loop
Gene family MIPF0001006; mir-961
Literature search

1 open access papers mention dme-mir-961
(1 sentences)

Stem-loop
   ucaa   -       a c      ca    -u   u        uu 
5'     ggg ccgaguu c uuugau  ccag  aac gagauugu  c
       ||| ||||||| | ||||||  ||||  ||| ||||||||  u
3'     cuc gguucaa g aaacua  gguc  uug cuuuggca  g
   --ag   a       - a      ac    uu   -        ua 
Get sequence
Deep sequencing
479 reads, 12.5 reads per million, 40 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 5641191-5641279 [+]
antisense
FBtr0079114 ; CG31646-RA; intron 4
Clustered miRNAs
< 10kb from dme-mir-961
dme-mir-959chr2L: 5640940-5641037 [+]
dme-mir-960chr2L: 5641063-5641155 [+]
dme-mir-961chr2L: 5641191-5641279 [+]
dme-mir-962chr2L: 5641298-5641389 [+]
dme-mir-963chr2L: 5641990-5642078 [+]
dme-mir-964chr2L: 5642102-5642201 [+]
Database links

Mature sequence dme-miR-961-5p

Accession MIMAT0005475
Previous IDsdme-miR-961
Sequence

18 - 

uuugaucaccaguaacugagau

 - 39

Get sequence
Deep sequencing254 reads, 37 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-961-3p

Accession MIMAT0020856
Sequence

55 - 

uucguuuucuggcaaucaaaag

 - 76

Get sequence
Deep sequencing219 reads, 27 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).