Stem-loop sequence dme-mir-375

AccessionMI0005813 (change log)
DescriptionDrosophila melanogaster miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

5 open access papers mention dme-mir-375
(6 sentences)

Stem-loop
   --c      gc   --uu            g  au       guga  a 
5'    cgggca  gaa    acuugggccaag ga  gcaaacu    uc u
      ||||||  |||    |||||||||||| ||  |||||||    || c
3'    gccugu  cuu    ugaauucgguuu cu  uguuuga    ag c
   uca      -a   uuau            g  --       ---a  c 
Get sequence
Deep sequencing
211224 reads, 1.24e+03 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 857542-857632 [+]
intergenic
Database links

Mature sequence dme-miR-375-5p

Accession MIMAT0020853
Sequence

15 - 

acuugggccaagggaaugcaaacu

 - 38

Get sequence
Deep sequencing1129 reads, 40 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-375-3p

Accession MIMAT0005472
Previous IDsdme-miR-375
Sequence

55 - 

uuuguucguuuggcuuaaguua

 - 76

Get sequence
Deep sequencing210094 reads, 46 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).