Stem-loop sequence dme-mir-957

AccessionMI0005811 (change log)
DescriptionDrosophila melanogaster miR-957 stem-loop
Gene family MIPF0000723; mir-957
Literature search

2 open access papers mention dme-mir-957
(2 sentences)

Stem-loop
   -u   -    aua a          c    u    ug  gugcug    gu 
5'   guc caca   g ccuuaguuuu gacg guuu  gu      ggga  u
     ||| ||||   | |||||||||| |||| ||||  ||      ||||   
3'   cgg gugu   c ggagucaaaa cugc caaa  ua      ccuu  c
   cg   a    caa c          c    -    gu  -----g    au 
Get sequence
Deep sequencing
499331 reads, 4.31e+03 reads per million, 42 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 22518196-22518291 [-]
intergenic
Database links

Mature sequence dme-miR-957-5p

Accession MIMAT0020851
Sequence

15 - 

cuuaguuuucgacguguuuuggu

 - 37

Get sequence
Deep sequencing259 reads, 27 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-957-3p

Accession MIMAT0005470
Previous IDsdme-miR-957
Sequence

61 - 

ugaaaccguccaaaacugaggc

 - 82

Get sequence
Deep sequencing499058 reads, 42 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).