Stem-loop sequence dme-mir-193

AccessionMI0005809 (change log)
DescriptionDrosophila melanogaster miR-193 stem-loop
Gene family MIPF0000082; mir-193
Literature search

7 open access papers mention dme-mir-193
(11 sentences)

Stem-loop
   ugug   c         g         uu   au   c  -----------u   u   a 
5'     ugc cuuauuaug uugggauuu  uag  cag ag            uau gcu u
       ||| ||||||||| |||||||||  |||  ||| ||            ||| |||  
3'     aug gaguaauac aacccugaa  auc  guc uc            aua cga a
   --aa   a         -         uc   cg   a  uucuaaauauuu   c   u 
Get sequence
Deep sequencing
25916 reads, 350 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 21574014-21574121 [+]
intergenic
Database links

Mature sequence dme-miR-193-5p

Accession MIMAT0020849
Sequence

19 - 

uugggauuuuuuagaucagcag

 - 40

Get sequence
Deep sequencing14717 reads, 41 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-193-3p

Accession MIMAT0005468
Previous IDsdme-miR-193
Sequence

73 - 

uacuggccuacuaagucccaac

 - 94

Get sequence
Deep sequencing11176 reads, 45 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).