Stem-loop sequence dme-mir-190

AccessionMI0005808 (change log)
DescriptionDrosophila melanogaster miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

9 open access papers mention dme-mir-190
(122 sentences)

Stem-loop
   cgaacuaauu  u   uc      -            au      u  uuu auu 
5'           ga ggu  caguga gauauguuugau  ucuugg ug   c   c
             || |||  |||||| ||||||||||||  |||||| ||   |    
3'           cu cca  gucauu uuauacaaacua  aggacc ac   g   a
   --------cg  c   gu      a            --      c  -uu aaa 
Get sequence
Deep sequencing
178603 reads, 1.13e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 8571799-8571898 [+]
sense
FBtr0333105 ; rhea-RE; intron 13
FBtr0333106 ; rhea-RF; intron 13
FBtr0305210 ; rhea-RB; intron 14
FBtr0333107 ; rhea-RG; intron 14
FBtr0333108 ; rhea-RH; intron 14
FBtr0333109 ; rhea-RI; intron 15
Database links

Mature sequence dme-miR-190-5p

Accession MIMAT0005467
Previous IDsdme-miR-190
Sequence

24 - 

agauauguuugauauucuugguug

 - 47

Get sequence
Deep sequencing175685 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-190-3p

Accession MIMAT0020848
Sequence

65 - 

cccaggaaucaaacauauuauu

 - 86

Get sequence
Deep sequencing2892 reads, 49 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).