|
miRBase |
|
Stem-loop sequence dme-mir-190 |
|||||
| Accession | MI0005808 | ||||
| Description | Drosophila melanogaster miR-190 stem-loop | ||||
| Gene family | MIPF0000076; mir-190 | ||||
| Stem-loop |
cgaacuaauu u uc - au u uuu auu ga ggu caguga gauauguuugau ucuugg ug c c || ||| |||||| |||||||||||| |||||| || | cu cca gucauu uuauacaaacua aggacc ac g a --------cg c gu a -- c -uu aaa |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence dme-miR-190-5p |
|
| Accession | MIMAT0005467 |
| Previous IDs | dme-miR-190 |
| Sequence |
24 - agauauguuugauauucuugguug - 47 |
| Deep sequencing | 25993 reads, 48 experiments |
| Evidence | experimental; 454 [1-2], Solexa [2] |
| Predicted targets |
|
Mature sequence dme-miR-190-3p |
|
| Accession | MIMAT0020848 |
| Sequence |
65 - cccaggaaucaaacauauuauu - 86 |
| Deep sequencing | 3149 reads, 48 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 2 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|