Stem-loop sequence dme-mir-iab-8

AccessionMI0005805 (change log)
Previous IDsdme-mir-iab4as;dme-mir-iab-4as
DescriptionDrosophila melanogaster miR-iab-8 stem-loop
Gene family MIPF0000854; mir-iab-8
Stem-loop
        uu            g    a  g  ua g 
5' ucgug  acguauacugaa guau cc ga  g a
   |||||  |||||||||||| |||| || ||  |  
3' agcau  ugcauaugacuu caua gg cu  c u
        -u            a    -  a  ca a 
Get sequence
Deep sequencing
532 reads, 6.45 reads per million, 31 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 16856275-16856342 [-]
sense
FBtr0306338 ; msa-RA; intron 4
FBtr0306339 ; msa-RB; intron 4
FBtr0309897 ; msa-RD; intron 5
FBtr0306340 ; msa-RC; intron 5
antisense
FBtr0083362 ; iab-4-RA; exon 3
Clustered miRNAs
< 10kb from dme-mir-iab-8
dme-mir-iab-8chr3R: 16856275-16856342 [-]
dme-mir-iab-4chr3R: 16856275-16856342 [+]
Database links

Mature sequence dme-miR-iab-8-5p

Accession MIMAT0005463
Previous IDsdme-miR-iab4as-5p;dme-miR-iab-4as-5p
Sequence

6 - 

uuacguauacugaagguauaccg

 - 28

Get sequence
Deep sequencing418 reads, 36 experiments
Evidence experimental; 454 [1], in-situ [2]
Database links
Predicted targets

Mature sequence dme-miR-iab-8-3p

Accession MIMAT0005464
Previous IDsdme-miR-iab4as-3p;dme-miR-iab-4as-3p
Sequence

44 - 

ggauacauucaguauacguuua

 - 65

Get sequence
Deep sequencing114 reads, 13 experiments
Evidence experimental; 454 [1], in-situ [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18172160 "A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands" Stark A, Bushati N, Jan CH, Kheradpour P, Hodges E, Brennecke J, Bartel DP, Cohen SM, Kellis M Genes Dev. 22:8-13(2008).