Stem-loop sequence osa-MIR529b

AccessionMI0005804 (change log)
DescriptionOryza sativa miR529b stem-loop
Gene family MIPF0000388; MIR529
Literature search

23 open access papers mention osa-MIR529b
(97 sentences)

Stem-loop
            -     au         a   a            ---gc  uu    uguuagau    gaa  a 
5' aucgugaag gcuaa  ggagaagag gag guacagcuuugg     gg  uagu        ggug   gu c
   ||||||||| |||||  ||||||||| ||| ||||||||||||     ||  ||||        ||||   ||  
3' uaguauuuu cgauu  cuucuucuc cuc caugucggaacc     uc  auca        ccgc   cg u
            u     cu         c   g            acuuu  cc    -------u    -ag  u 
Get sequence
Deep sequencing
457 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 15883024-15883161 [+]
intergenic
Database links

Mature sequence osa-miR529b

Accession MIMAT0005015
Sequence

19 - 

agaagagagagaguacagcuu

 - 39

Get sequence
Deep sequencing456 reads, 2 experiments
Evidence experimental; cloned [1], 454 [2]
Database links

References

1
2
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).