Stem-loop sequence bna-MIR399a

AccessionMI0005774 (change log)
Previous IDsbna-MIR399
DescriptionBrassica napus miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention bna-MIR399a
(16 sentences)

Stem-loop
   aca     a       a        a   -      uu     uu    ucu 
5'    gggca gaucucu uuggcaga aac cauuac  agauc  ugca   c
      ||||| ||||||| |||||||| ||| ||||||  |||||  ||||    
3'    cccgu uuagagg aaccgucu uug gugaug  uuuag  acgu   u
   ugg     -       a        c   a      --     uu    cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:CX190537: 26-127 [+]
intergenic
Database links

Mature sequence bna-miR399a

Accession MIMAT0004449
Previous IDsbna-miR399
Sequence

81 - 

ugccaaaggagauuugcccgg

 - 101

Get sequence
Evidence experimental; RTPCR [1]

References

1
PMID:17367786 "Computational identification of novel microRNAs and targets in Brassica napus" Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, Nie L, Yang ZM FEBS Lett. 581:1464-1474(2007).