Stem-loop sequence bna-MIR396a

AccessionMI0005773 (change log)
DescriptionBrassica napus miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention bna-MIR396a
(22 sentences)

Stem-loop
               c    a    c     cauuuccc   uuuuas  c  -aa   aa 
5' uuccacagcuuu uuga cuuu uuuuu        uua      ag ga   uua  u
   |||||||||||| |||| |||| |||||        |||      || ||   |||   
3' agggugucgaaa aacu gaaa aaaaa        aau      uc cu   aau  a
               s    c    a     saucucac   uuacaa  u  aaa   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BQ704984: 390-506 [-]
intergenic
Database links

Mature sequence bna-miR396a

Accession MIMAT0004448
Sequence

1 - 

uuccacagcuuucuugaacuu

 - 21

Get sequence
Evidence experimental; RTPCR [1]

References

1
PMID:17367786 "Computational identification of novel microRNAs and targets in Brassica napus" Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, Nie L, Yang ZM FEBS Lett. 581:1464-1474(2007).