Stem-loop sequence bna-MIR393

AccessionMI0005772 (change log)
DescriptionBrassica napus miR393 stem-loop
Gene family MIPF0000083; MIR393
Literature search

5 open access papers mention bna-MIR393
(20 sentences)

Stem-loop
      a            u     ---u   c    ugaguuauucccgaauaauuauuuuaauuu 
5' ucc aagggaucgcau gaucc    aau aagc                              u
   ||| |||||||||||| |||||    ||| ||||                              u
3' agg uucucuagcgua cuagg    uug uucg                              u
      c            -     ccuu   c    uuuuaaaaaaaaaagauagaaagguaacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DU101699: 116-242 [+]
intergenic
Database links

Mature sequence bna-miR393

Accession MIMAT0004447
Sequence

1 - 

uccaaagggaucgcauugauc

 - 21

Get sequence
Evidence experimental; RTPCR [1]

References

1
PMID:17367786 "Computational identification of novel microRNAs and targets in Brassica napus" Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, Nie L, Yang ZM FEBS Lett. 581:1464-1474(2007).