Stem-loop sequence bna-MIR171g

AccessionMI0005771 (change log)
Previous IDsbna-MIR171
DescriptionBrassica napus miR171g stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171g
(14 sentences)

Stem-loop
   --         c       c      uacacacgu    uaugc 
5'   gauauuggc ugguuca ucagau         acua     a
     ||||||||| ||||||| ||||||         ||||      
3'   cuauaaccg gccgagu agucua         ugau     u
   cu         c       u      --------u    ucucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bna-miR171g

Accession MIMAT0004446
Previous IDsbna-miR171
Sequence

58 - 

ugauugagccgcgccaauaucu

 - 79

Get sequence
Evidence experimental; RTPCR [1], cloned [2]

References

1
PMID:17367786 "Computational identification of novel microRNAs and targets in Brassica napus" Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, Nie L, Yang ZM FEBS Lett. 581:1464-1474(2007).
2
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).