|
miRBase |
|
Stem-loop sequence bna-MIR171g |
|||||
| Accession | MI0005771 | ||||
| Previous IDs | bna-MIR171 | ||||
| Description | Brassica napus miR171g stem-loop | ||||
| Gene family | MIPF0000030; MIR171_1 | ||||
| Stem-loop |
-- c c uacacacgu uaugc gauauuggc ugguuca ucagau acua a ||||||||| ||||||| |||||| |||| cuauaaccg gccgagu agucua ugau u cu c u --------u ucucu |
||||
| Genome context |
|
||||
Mature sequence bna-miR171g |
|
| Accession | MIMAT0004446 |
| Previous IDs | bna-miR171 |
| Sequence |
58 - ugauugagccgcgccaauaucu - 79 |
| Evidence | experimental; RTPCR [1], cloned [2] |
References |
|
| 1 |
PMID:17367786
"Computational identification of novel microRNAs and targets in Brassica napus"
FEBS Lett. 581:1464-1474(2007).
|
| 2 |
PMID:17659282
"Cloning and characterization of microRNAs from Brassica napus"
FEBS Lett. 581:3848-3856(2007).
|