Stem-loop sequence bna-MIR156a

AccessionMI0005770 (change log)
DescriptionBrassica napus miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

13 open access papers mention bna-MIR156a
(206 sentences)

Stem-loop
   -        -   -         a   ---      uc    u 
5'  ugacagaa gag agugagcac caa   aaguaa  ugca a
    |||||||| ||| ||||||||| |||   ||||||  |||| u
3'  acugucuu cuc ucacucgug guu   uucguu  acgu a
   g        u   g         c   cuc      -u    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:CD835236: 102-183 [+]
intergenic
Database links

Mature sequence bna-miR156a

Accession MIMAT0004445
Sequence

1 - 

ugacagaagagagugagcaca

 - 21

Get sequence
Evidence experimental; RTPCR [1]

References

1
PMID:17367786 "Computational identification of novel microRNAs and targets in Brassica napus" Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, Nie L, Yang ZM FEBS Lett. 581:1464-1474(2007).