Stem-loop sequence hsa-mir-944

AccessionMI0005769
Symbol HGNC:MIR944
DescriptionHomo sapiens miR-944 stem-loop
Gene family MIPF0000541; mir-944
Stem-loop
               u          a       u      aaauu 
5' guuccagacaca cucaucugau uacaaua uuucuu     g
   |||||||||||| |||||||||| ||||||| ||||||      
3' uagggucugugu gaguaggcua auguuau aaagag     u
               c          c       u      aaaua 
Get sequence
Deep sequencing
1005 reads, 864 reads per million, 37 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 189829922-189830009 [+]
antisense
OTTHUMT00000343855 ; LEPREL1-001; intron 1
OTTHUMT00000343856 ; LEPREL1-002; intron 1
OTTHUMT00000343858 ; LEPREL1-004; intron 1
OTTHUMT00000343857 ; LEPREL1-003; intron 1
ENST00000319332 ; LEPREL1-001; intron 1
ENST00000427335 ; LEPREL1-002; intron 1
ENST00000444866 ; LEPREL1-004; intron 1
ENST00000426003 ; LEPREL1-003; intron 1
Database links

Mature sequence hsa-miR-944

Accession MIMAT0004987
Sequence

54 - 

aaauuauuguacaucggaugag

 - 75

Get sequence
Deep sequencing383 reads, 30 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).