Stem-loop sequence hsa-mir-944

Accession

MI0005769

Symbol

HGNC:MIR944

Description

Homo sapiens miR-944 stem-loop

Gene family

MIPF0000541; mir-944

Stem-loop

            u          a       u      aaauu 
guuccagacaca cucaucugau uacaaua uuucuu     g
|||||||||||| |||||||||| ||||||| ||||||      
uagggucugugu gaguaggcua auguuau aaagag     u
            c          c       u      aaaua 

Deep sequencing

333 reads, 19 experiments

Genome context

• Coordinates (GRCh37.p5): chr3: 189547711-189547798 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000343876 ; TP63-012; intron 1

  OTTHUMT00000343876 ; TP63-012; intron 1

  OTTHUMT00000343876 ; TP63-012; intron 1

  OTTHUMT00000343868 ; TP63-004; intron 2

  OTTHUMT00000343871 ; TP63-007; intron 2

  OTTHUMT00000343869 ; TP63-005; intron 2

  OTTHUMT00000343873 ; TP63-009; intron 2

  OTTHUMT00000343875 ; TP63-011; intron 2

  OTTHUMT00000343879 ; TP63-015; intron 2

  OTTHUMT00000343877 ; TP63-013; intron 2

  OTTHUMT00000343868 ; TP63-004; intron 2

  OTTHUMT00000343871 ; TP63-007; intron 2

  OTTHUMT00000343869 ; TP63-005; intron 2

  OTTHUMT00000343873 ; TP63-009; intron 2

  OTTHUMT00000343875 ; TP63-011; intron 2

  OTTHUMT00000343879 ; TP63-015; intron 2

  OTTHUMT00000343877 ; TP63-013; intron 2

  OTTHUMT00000343868 ; TP63-004; intron 2

  OTTHUMT00000343871 ; TP63-007; intron 2

  OTTHUMT00000343869 ; TP63-005; intron 2

  OTTHUMT00000343873 ; TP63-009; intron 2

  OTTHUMT00000343875 ; TP63-011; intron 2

  OTTHUMT00000343879 ; TP63-015; intron 2

  OTTHUMT00000343877 ; TP63-013; intron 2

  OTTHUMT00000343878 ; TP63-014; intron 3

  OTTHUMT00000343878 ; TP63-014; intron 3

  OTTHUMT00000343878 ; TP63-014; intron 3

  OTTHUMT00000343865 ; TP63-001; intron 4

  OTTHUMT00000343866 ; TP63-002; intron 4

  OTTHUMT00000343867 ; TP63-003; intron 4

  OTTHUMT00000343874 ; TP63-010; intron 4

  OTTHUMT00000343872 ; TP63-008; intron 4

  OTTHUMT00000343865 ; TP63-001; intron 4

  OTTHUMT00000343866 ; TP63-002; intron 4

  OTTHUMT00000343867 ; TP63-003; intron 4

  OTTHUMT00000343874 ; TP63-010; intron 4

  OTTHUMT00000343872 ; TP63-008; intron 4

  OTTHUMT00000343865 ; TP63-001; intron 4

  OTTHUMT00000343866 ; TP63-002; intron 4

  OTTHUMT00000343867 ; TP63-003; intron 4

  OTTHUMT00000343874 ; TP63-010; intron 4

  OTTHUMT00000343872 ; TP63-008; intron 4

  ENST00000449992 ; TP63-012; intron 1

  ENST00000449992 ; TP63-012; intron 1

  ENST00000449992 ; TP63-012; intron 1

  ENST00000354600 ; TP63-004; intron 2

  ENST00000434928 ; TP63-007; intron 2

  ENST00000460036 ; TP63-005; intron 2

  ENST00000437221 ; TP63-009; intron 2

  ENST00000392463 ; TP63-011; intron 2

  ENST00000392461 ; TP63-015; intron 2

  ENST00000456148 ; TP63-013; intron 2

  ENST00000354600 ; TP63-004; intron 2

  ENST00000434928 ; TP63-007; intron 2

  ENST00000460036 ; TP63-005; intron 2

  ENST00000437221 ; TP63-009; intron 2

  ENST00000392463 ; TP63-011; intron 2

  ENST00000392461 ; TP63-015; intron 2

  ENST00000456148 ; TP63-013; intron 2

  ENST00000354600 ; TP63-004; intron 2

  ENST00000434928 ; TP63-007; intron 2

  ENST00000460036 ; TP63-005; intron 2

  ENST00000437221 ; TP63-009; intron 2

  ENST00000392463 ; TP63-011; intron 2

  ENST00000392461 ; TP63-015; intron 2

  ENST00000456148 ; TP63-013; intron 2

  ENST00000382063 ; TP63-014; intron 3

  ENST00000382063 ; TP63-014; intron 3

  ENST00000382063 ; TP63-014; intron 3

  ENST00000264731 ; TP63-001; intron 4

  ENST00000418709 ; TP63-002; intron 4

  ENST00000320472 ; TP63-003; intron 4

  ENST00000392460 ; TP63-010; intron 4

  ENST00000440651 ; TP63-008; intron 4

  ENST00000264731 ; TP63-001; intron 4

  ENST00000418709 ; TP63-002; intron 4

  ENST00000320472 ; TP63-003; intron 4

  ENST00000392460 ; TP63-010; intron 4

  ENST00000440651 ; TP63-008; intron 4

  ENST00000264731 ; TP63-001; intron 4

  ENST00000418709 ; TP63-002; intron 4

  ENST00000320472 ; TP63-003; intron 4

  ENST00000392460 ; TP63-010; intron 4

  ENST00000440651 ; TP63-008; intron 4

Database links

• ENTREZGENE: 100126340;MIR944
• HGNC: 33690;MIR944

Mature sequence hsa-miR-944

• Accession: MIMAT0004987
• Sequence: 54 - aaauuauuguacaucggaugag - 75
• Deep sequencing: 333 reads, 19 experiments
• Evidence: experimental; cloned [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-944
  • MICRORNA.ORG:hsa-miR-944
  • MIRDB:hsa-miR-944
  • RNA22-HSA:hsa-miR-944
  • TARGETMINER:hsa-miR-944
  • TARGETSCAN-VERT:hsa-miR-944

References

1. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).