|
miRBase |
|
Stem-loop sequence hsa-mir-942 |
|||||
| Accession | MI0005767 | ||||
| Symbol | HGNC:MIR942 | ||||
| Description | Homo sapiens miR-942 stem-loop | ||||
| Gene family | MIPF0000511; mir-942 | ||||
| Stem-loop |
u uacuca auuaggagagua cuucucuguuuuggccaugugug c |||||||||||| ||||||||||||||||||||||| uaauccuuucau gaagagacaaagccgguacacac a u uccccg |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-942 |
|
| Accession | MIMAT0004985 |
| Sequence |
13 - ucuucucuguuuuggccaugug - 34 |
| Deep sequencing | 89 reads, 12 experiments |
| Evidence | experimental; cloned [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|