Stem-loop sequence hsa-mir-942

Accession MI0005767
Symbol HGNC:MIR942
Description Homo sapiens miR-942 stem-loop
Gene family MIPF0000511; mir-942
Stem-loop
            u                       uacuca 
auuaggagagua cuucucuguuuuggccaugugug      c
|||||||||||| |||||||||||||||||||||||       
uaauccuuucau gaagagacaaagccgguacacac      a
            u                       uccccg 
Get sequence
Deep sequencing
105 reads, 16 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 117637265-117637350 [+]
sense
OTTHUMT00000033314 ; TTF2-003; intron 1
OTTHUMT00000033314 ; TTF2-003; intron 1
OTTHUMT00000033314 ; TTF2-003; intron 1
OTTHUMT00000033277 ; TTF2-001; intron 18
OTTHUMT00000033277 ; TTF2-001; intron 18
OTTHUMT00000033277 ; TTF2-001; intron 18
ENST00000492682 ; TTF2-003; intron 1
ENST00000492682 ; TTF2-003; intron 1
ENST00000492682 ; TTF2-003; intron 1
ENST00000369466 ; TTF2-001; intron 18
ENST00000369466 ; TTF2-001; intron 18
ENST00000369466 ; TTF2-001; intron 18
Database links

Mature sequence hsa-miR-942

Accession MIMAT0004985
Sequence

13 - 

ucuucucuguuuuggccaugug

 - 34

Get sequence
Deep sequencing 89 reads, 12 experiments
Evidence experimental; cloned [1]
Validated targets
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).