Stem-loop sequence hsa-mir-940

AccessionMI0005762 (change log)
Symbol HGNC:MIR940
DescriptionHomo sapiens miR-940 stem-loop
Gene family MIPF0000540; mir-940
Literature search

36 open access papers mention hsa-mir-940
(333 sentences)

Stem-loop
      a   g         cccca         -   gg  -ag  --  gug 
5' gug ggu ugggcccgg     ggagcgggg ccu  gc   cc  cc   u
   ||| ||| |||||||||     ||||||||| |||  ||   ||  ||   g
3' cac cca guccgggcc     ccucgcccc ggg  cg   gg  gg   u
      c   -         -----         c   -a  gaa  aa  agu 
Get sequence
Deep sequencing
4714 reads, 0.8 reads per million, 125 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 2271747-2271840 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-940
hsa-mir-3677chr16: 2270713-2270772 [+]
hsa-mir-940chr16: 2271747-2271840 [+]
hsa-mir-4717chr16: 2274620-2274691 [+]
Database links

Mature sequence hsa-miR-940

Accession MIMAT0004983
Sequence

60 - 

aaggcagggcccccgcucccc

 - 80

Get sequence
Deep sequencing4642 reads, 127 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).