Stem-loop sequence hsa-mir-939

AccessionMI0005761
Symbol HGNC:MIR939
DescriptionHomo sapiens miR-939 stem-loop
Gene family MIPF0000490; mir-939
Stem-loop
   u    gca    c         u     u ug   gu   c 
5'  gugg   gggc cuggggagc gaggc c  ggg  ggc g
    ||||   |||| ||||||||| ||||| |  |||  |||  
3'  cgcc   ucug gaccccucg cuccg g  ccc  ucg g
   g    -ag    u         u     - gu   ag   g 
Get sequence
Deep sequencing
55 reads, 92.7 reads per million, 23 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr8: 144394149-144394230 [-]
sense
OTTHUMT00000381321 ; TOP1MT-013; intron 1
OTTHUMT00000381247 ; TOP1MT-001; intron 12
OTTHUMT00000381248 ; TOP1MT-002; intron 12
OTTHUMT00000381294 ; TOP1MT-003; intron 13
OTTHUMT00000381295 ; TOP1MT-005; intron 13
ENST00000519977 ; TOP1MT-013; intron 1
ENST00000329245 ; TOP1MT-001; intron 12
ENST00000519148 ; TOP1MT-002; intron 12
ENST00000521193 ; TOP1MT-003; intron 13
ENST00000523676 ; TOP1MT-005; intron 13
Clustered miRNAs
< 10kb from hsa-mir-939
hsa-mir-6849chr8: 144400277-144400345 [-]
hsa-mir-1234chr8: 144400086-144400165 [-]
hsa-mir-939chr8: 144394149-144394230 [-]
Database links

Mature sequence hsa-miR-939-5p

Accession MIMAT0004982
Previous IDshsa-miR-939
Sequence

15 - 

uggggagcugaggcucugggggug

 - 38

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-939-3p

Accession MIMAT0022939
Sequence

50 - 

cccugggccucugcuccccag

 - 70

Get sequence
Deep sequencing11 reads, 7 experiments
Evidence not experimental

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).