|
miRBase |
|
Stem-loop sequence hsa-mir-935 |
|||||
| Accession | MI0005757 | ||||
| Symbol | HGNC:MIR935 | ||||
| Description | Homo sapiens miR-935 stem-loop | ||||
| Gene family | MIPF0000606; mir-935 | ||||
| Stem-loop |
gcg a ccc c caucc ggcgggggc ggcggc guggcgggagcgg cu ggc u ||||||||| |||||| ||||||||||||| || ||| ucgcccucg ccgccg caucgccuucgcc ga ccg c --- c auu c ucugc |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-935 |
|
| Accession | MIMAT0004978 |
| Sequence |
56 - ccaguuaccgcuuccgcuaccgc - 78 |
| Deep sequencing | 37 reads, 8 experiments |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|