Stem-loop sequence hsa-mir-933

AccessionMI0005755 (change log)
Symbol HGNC:MIR933
DescriptionHomo sapiens miR-933 stem-loop
Gene family MIPF0000505; mir-933
Literature search

2 open access papers mention hsa-mir-933
(6 sentences)

Stem-loop
      -     caguuc       -   g g       u ga 
5' acu ugggu      agagguc cuc g gcgcgcg c  g
   ||| |||||      ||||||| ||| | ||||||| |   
3' uga accca      ucuccag ggg c cgugugc g  u
      c     ---ccc       a   a g       c ac 
Get sequence
Deep sequencing
342 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 175167633-175167709 [-]
intergenic
Database links

Mature sequence hsa-miR-933

Accession MIMAT0004976
Sequence

47 - 

ugugcgcagggagaccucuccc

 - 68

Get sequence
Deep sequencing298 reads, 50 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).