Stem-loop sequence hsa-mir-933

Accession

MI0005755

Symbol

HGNC:MIR933

Description

Homo sapiens miR-933 stem-loop

Gene family

MIPF0000505; mir-933

Stem-loop

   -     caguuc       -   g g       u ga 
acu ugggu      agagguc cuc g gcgcgcg c  g
||| |||||      ||||||| ||| | ||||||| |   
uga accca      ucuccag ggg c cgugugc g  u
   c     ---ccc       a   a g       c ac 

Deep sequencing

13 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr2: 176032361-176032437 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000255562 ; ATF2-001; intron 1

  OTTHUMT00000334483 ; ATF2-013; intron 1

  OTTHUMT00000334482 ; ATF2-012; intron 1

  OTTHUMT00000334478 ; ATF2-008; intron 1

  OTTHUMT00000334472 ; ATF2-002; intron 1

  OTTHUMT00000334473 ; ATF2-003; intron 1

  OTTHUMT00000334474 ; ATF2-004; intron 1

  OTTHUMT00000334475 ; ATF2-005; intron 1

  OTTHUMT00000334476 ; ATF2-006; intron 1

  OTTHUMT00000334477 ; ATF2-007; intron 1

  OTTHUMT00000334484 ; ATF2-014; intron 1

  OTTHUMT00000334490 ; ATF2-020; intron 1

  OTTHUMT00000334485 ; ATF2-015; intron 1

  OTTHUMT00000334479 ; ATF2-009; intron 1

  OTTHUMT00000334487 ; ATF2-017; intron 1

  OTTHUMT00000334486 ; ATF2-016; intron 1

  OTTHUMT00000255562 ; ATF2-001; intron 1

  OTTHUMT00000334483 ; ATF2-013; intron 1

  OTTHUMT00000334482 ; ATF2-012; intron 1

  OTTHUMT00000334478 ; ATF2-008; intron 1

  OTTHUMT00000334472 ; ATF2-002; intron 1

  OTTHUMT00000334473 ; ATF2-003; intron 1

  OTTHUMT00000334474 ; ATF2-004; intron 1

  OTTHUMT00000334475 ; ATF2-005; intron 1

  OTTHUMT00000334476 ; ATF2-006; intron 1

  OTTHUMT00000334477 ; ATF2-007; intron 1

  OTTHUMT00000334484 ; ATF2-014; intron 1

  OTTHUMT00000334490 ; ATF2-020; intron 1

  OTTHUMT00000334485 ; ATF2-015; intron 1

  OTTHUMT00000334479 ; ATF2-009; intron 1

  OTTHUMT00000334487 ; ATF2-017; intron 1

  OTTHUMT00000334486 ; ATF2-016; intron 1

  OTTHUMT00000255562 ; ATF2-001; intron 1

  OTTHUMT00000334483 ; ATF2-013; intron 1

  OTTHUMT00000334482 ; ATF2-012; intron 1

  OTTHUMT00000334478 ; ATF2-008; intron 1

  OTTHUMT00000334472 ; ATF2-002; intron 1

  OTTHUMT00000334473 ; ATF2-003; intron 1

  OTTHUMT00000334474 ; ATF2-004; intron 1

  OTTHUMT00000334475 ; ATF2-005; intron 1

  OTTHUMT00000334476 ; ATF2-006; intron 1

  OTTHUMT00000334477 ; ATF2-007; intron 1

  OTTHUMT00000334484 ; ATF2-014; intron 1

  OTTHUMT00000334490 ; ATF2-020; intron 1

  OTTHUMT00000334485 ; ATF2-015; intron 1

  OTTHUMT00000334479 ; ATF2-009; intron 1

  OTTHUMT00000334487 ; ATF2-017; intron 1

  OTTHUMT00000334486 ; ATF2-016; intron 1

  ENST00000264110 ; ATF2-001; intron 1

  ENST00000345739 ; ATF2-013; intron 1

  ENST00000409635 ; ATF2-012; intron 1

  ENST00000428760 ; ATF2-008; intron 1

  ENST00000392544 ; ATF2-002; intron 1

  ENST00000417080 ; ATF2-003; intron 1

  ENST00000456655 ; ATF2-004; intron 1

  ENST00000421438 ; ATF2-005; intron 1

  ENST00000429579 ; ATF2-006; intron 1

  ENST00000415955 ; ATF2-007; intron 1

  ENST00000409499 ; ATF2-014; intron 1

  ENST00000435231 ; ATF2-020; intron 1

  ENST00000437522 ; ATF2-015; intron 1

  ENST00000409833 ; ATF2-009; intron 1

  ENST00000413123 ; ATF2-017; intron 1

  ENST00000445349 ; ATF2-016; intron 1

  ENST00000542046 ; ATF2-205; intron 1

  ENST00000426833 ; ATF2-202; intron 1

  ENST00000392543 ; ATF2-201; intron 1

  ENST00000538946 ; ATF2-204; intron 1

  ENST00000487334 ; ATF2-203; intron 1

  ENST00000264110 ; ATF2-001; intron 1

  ENST00000345739 ; ATF2-013; intron 1

  ENST00000409635 ; ATF2-012; intron 1

  ENST00000428760 ; ATF2-008; intron 1

  ENST00000392544 ; ATF2-002; intron 1

  ENST00000417080 ; ATF2-003; intron 1

  ENST00000456655 ; ATF2-004; intron 1

  ENST00000421438 ; ATF2-005; intron 1

  ENST00000429579 ; ATF2-006; intron 1

  ENST00000415955 ; ATF2-007; intron 1

  ENST00000409499 ; ATF2-014; intron 1

  ENST00000435231 ; ATF2-020; intron 1

  ENST00000437522 ; ATF2-015; intron 1

  ENST00000409833 ; ATF2-009; intron 1

  ENST00000413123 ; ATF2-017; intron 1

  ENST00000445349 ; ATF2-016; intron 1

  ENST00000542046 ; ATF2-205; intron 1

  ENST00000426833 ; ATF2-202; intron 1

  ENST00000392543 ; ATF2-201; intron 1

  ENST00000538946 ; ATF2-204; intron 1

  ENST00000487334 ; ATF2-203; intron 1

  ENST00000264110 ; ATF2-001; intron 1

  ENST00000345739 ; ATF2-013; intron 1

  ENST00000409635 ; ATF2-012; intron 1

  ENST00000428760 ; ATF2-008; intron 1

  ENST00000392544 ; ATF2-002; intron 1

  ENST00000417080 ; ATF2-003; intron 1

  ENST00000456655 ; ATF2-004; intron 1

  ENST00000421438 ; ATF2-005; intron 1

  ENST00000429579 ; ATF2-006; intron 1

  ENST00000415955 ; ATF2-007; intron 1

  ENST00000409499 ; ATF2-014; intron 1

  ENST00000435231 ; ATF2-020; intron 1

  ENST00000437522 ; ATF2-015; intron 1

  ENST00000409833 ; ATF2-009; intron 1

  ENST00000413123 ; ATF2-017; intron 1

  ENST00000445349 ; ATF2-016; intron 1

  ENST00000542046 ; ATF2-205; intron 1

  ENST00000426833 ; ATF2-202; intron 1

  ENST00000392543 ; ATF2-201; intron 1

  ENST00000538946 ; ATF2-204; intron 1

  ENST00000487334 ; ATF2-203; intron 1

Database links

• ENTREZGENE: 100126350;MIR933
• HGNC: 33676;MIR933

Mature sequence hsa-miR-933

• Accession: MIMAT0004976
• Sequence: 47 - ugugcgcagggagaccucuccc - 68
• Deep sequencing: 13 reads, 5 experiments
• Evidence: experimental; cloned [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-933
  • MICRORNA.ORG:hsa-miR-933
  • MIRDB:hsa-miR-933
  • RNA22-HSA:hsa-miR-933
  • TARGETMINER:hsa-miR-933
  • TARGETSCAN-VERT:hsa-miR-933

References

1. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).