Stem-loop sequence ame-mir-927a

AccessionMI0005748 (change log)
Previous IDsame-mir-927
DescriptionApis mellifera miR-927 stem-loop
Gene family MIPF0000452; mir-927
Literature search

1 open access papers mention ame-mir-927a
(1 sentences)

Stem-loop
   -agauaaaagc   -              a   cu       a   a gu 
5'            gug guauuuguuuuaga uuc  acgcuuu ccg u  u
              ||| |||||||||||||| |||  ||||||| ||| |   
3'            uac cguaagcaaagucu aag  ugcgaaa ggu a  c
   cuacuuccaaa   g              a   uu       c   g ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 7594659-7594758 [-]
intergenic
Database links

Mature sequence ame-miR-927a-5p

Accession MIMAT0004438
Previous IDsame-miR-927
Sequence

21 - 

uuuuagaauuccuacgcuuuacc

 - 43

Get sequence
Evidence experimental; array [1], RTPCR [1], Illumina [2-3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).