Dead miRNA entry

miRNA accession:
MI0005746
miRNA ID:
ame-mir-925
Comment:
miR-925 appears to be a misannotated fragment HRNBP1 coding seqeunce (Peterson K, pers. comm.), so is removed from the database.

Previous miRNA entry

Stem-loop sequence ame-mir-925

AccessionMI0005746 (change log)
DescriptionApis mellifera miR-925 stem-loop
Stem-loop
   ----------------ucuguccuu  -aug  g ga        u  aa  uu   a 
5'                          gc    ca g  uucgguuu gu  ca  cgc a
                            ||    || |  |||||||| ||  ||  ||| a
3'                          cg    gu c  gggccagg cg  gu  gug u
   gacgggaguuggugccacggcacau  gaga  g ac        -  ca  -c   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links