Stem-loop sequence ame-mir-375

AccessionMI0005740 (change log)
DescriptionApis mellifera miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

7 open access papers mention ame-mir-375
(18 sentences)

Stem-loop
   aucgauugaauua           ca    u  u     uca          c 
5'              ucaguuuggug  ucga cc aacga   acaaacuuuu a
                |||||||||||  |||| || |||||   |||||||||| c
3'              agucaaacuau  agcu gg uugcu   uguuugaaag u
   ------guaggua           ug    c  c     ---          u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 5038235-5038334 [+]
intergenic
Database links

Mature sequence ame-miR-375-3p

Accession MIMAT0004431
Sequence

63 - 

uuuguucguucggcucgaguua

 - 84

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).