Stem-loop sequence ame-mir-13a

Accession MI0005730
Description Apis mellifera miR-13a stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
accgaaaugaaaauacc        u    -ua       u         a   uuu 
                 uuuugcgg ccga   caucaaa ugguugugg aug   c
                 |||||||| ||||   ||||||| ||||||||| |||    
                 aagacgcc gguu   guaguuu accgacacu uac   g
---------------cu        c    cga       u         a   uga 
Get sequence
Deep sequencing
3 reads, 1 experiments
Genome context
Coordinates (Amel_4.0) Overlapping transcripts
Group1.1: 136460-136559 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-13a
ame-mir-71 Group1.1: 137128-137227 [-]
ame-mir-2-3 Group1.1: 136741-136840 [-]
ame-mir-13a Group1.1: 136460-136559 [-]
ame-mir-13b Group1.1: 136119-136197 [-]
ame-mir-2-1 Group1.1: 135899-135987 [-]
ame-mir-2-2 Group1.1: 134955-135038 [-]
Database links

Mature sequence ame-miR-13a

Accession MIMAT0004422
Sequence

64 - 

uaucacagccauuuugaugag

 - 84

Get sequence
Evidence by similarity; MI0000133

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).