Stem-loop sequence ame-mir-13a

AccessionMI0005730 (change log)
DescriptionApis mellifera miR-13a stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention ame-mir-13a
(7 sentences)

Stem-loop
   accgaaaugaaaauacc        u    -ua       u         a   uuu 
5'                  uuuugcgg ccga   caucaaa ugguugugg aug   c
                    |||||||| ||||   ||||||| ||||||||| |||    
3'                  aagacgcc gguu   guaguuu accgacacu uac   g
   ---------------cu        c    cga       u         a   uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 1246352-1246451 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-13a
ame-mir-71CM000054.5: 1245684-1245783 [+]
ame-mir-2-3CM000054.5: 1246071-1246170 [+]
ame-mir-13aCM000054.5: 1246352-1246451 [+]
ame-mir-13bCM000054.5: 1246714-1246792 [+]
ame-mir-2-1CM000054.5: 1246924-1247012 [+]
ame-mir-2bCM000054.5: 1246930-1247007 [-]
ame-mir-2-2CM000054.5: 1247873-1247956 [+]
Database links

Mature sequence ame-miR-13a-3p

Accession MIMAT0004422
Sequence

64 - 

uaucacagccauuuugaugag

 - 84

Get sequence
Evidence experimental; RTPCR [2], Illumina [3-4]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
4
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).