Stem-loop sequence ame-mir-100

AccessionMI0005728 (change log)
DescriptionApis mellifera miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

7 open access papers mention ame-mir-100
(13 sentences)

Stem-loop
   --   aua      g   cua   c      cc  a       gcuuuuu 
5'   gcu   cuugau aua   acc guagau  ga cuugugg       u
     |||   |||||| |||   ||| ||||||  || |||||||       a
3'   cga   ggacug ugu   ugg caucua  cu gaacgcc       u
   ua   -cc      a   aca   c      uc  c       auaugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 8436007-8436106 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-100
ame-mir-100CM000061.5: 8436007-8436106 [+]
ame-let-7CM000061.5: 8436647-8436746 [+]
ame-mir-125CM000061.5: 8437175-8437281 [+]
Database links

Mature sequence ame-miR-100-5p

Accession MIMAT0004420
Sequence

19 - 

aacccguagauccgaacuugug

 - 40

Get sequence
Evidence experimental; array [1], Illumina [2-3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).