Stem-loop sequence ame-mir-10

AccessionMI0005727 (change log)
Previous IDsame-mir-10-1
DescriptionApis mellifera miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ame-mir-10
(11 sentences)

Stem-loop
   ccc    ---a    u      cu   -  g    u           ugau 
5'    aguu    augc cuacau  acc cu uaga ccgaauuuguu    a
      ||||    |||| ||||||  ||| || |||| |||||||||||    a
3'    ucga    uacg ggugug  ugg ga aucu ggcuuaaacag    g
   -ca    gaca    u      uu   a  g    u           cgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 2496380-2496479 [-]
intergenic
Database links

Mature sequence ame-miR-10-5p

Accession MIMAT0004419
Sequence

22 - 

acccuguagauccgaauuugu

 - 42

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).