miRBase
|
|
miRBase |
|
|
||
Stem-loop sequence cgr-mir-21 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Accession | MI0005725 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Description | Cricetulus griseus miR-21 stem-loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000060; mir-21 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.
microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene.[1] MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.
[edit] Mature miR-21Pri-miR-21 is cut by the endonuclease Drosha in the nucleus to produce pre-miR-21, which is exported into the cytosol. This pre-miR-21 is then cut in to a short RNA duplex by Dicer in the cytosol. Although abundance of both strands is equal by transcription, only one strand (miR-21) is selected for processing as mature microRNA based on the thermodynamic stability of each end of the duplex, while the other strand (designated with an asterisk; miR-21*) is generally degraded. Mature microRNA is then loaded into microRNA ribonucleoprotein complex RISC (RNA-induced silencing complex) and guided to target mRNAs with near perfect complimentarily at 3’UTR. [edit] TargetsA number of targets for microRNA-21 have been experimentally validated and most of them are tumor suppressors. Notable targets include PTEN,[2] PDCD4,[3] Tropomyosin,[4] Sprouty 1,[5] Sprouty 2,[6] Bcl2,[7] RECK,[8] IL-12p35,[9] JAG1,[10] HNRPK,[4] BTG2,[11] TGFBRII,[12] TAp63,[4] P12/CDK2AP1,[13] MEF2C,[14] ANP32A, SMARCA4,[15] RhoB,[16] and hMSH2.[17] [edit] Clinical significance[edit] CancerMiR-21 is one of the first microRNA to be described as an oncomir. As most of the targets of miR-21 are tumor suppressors, miR-21 is associated with a wide variety of cancers including that of breast,[18] ovaries,[19] cervix,[20] colon,[3] lung,[21] liver,[2] brain,[22] esophagus,[23] prostate,[21] pancreas,[21] and thyroid.[24] [edit] Cardiac diseasemiR-21 has been shown to play important role in development of heart disease. It is one of the microRNAs whose expression is increased in failing murine and human hearts.[5][25] Further, inhibition of microRNAs in mice using chemically modified and cholesterol-conjugated miRNA inhibitors (antagomirs) was shown to inhibit interstitial fibrosis and improve cardiac function in a pressure- overload cardiac disease mice model.[5] Surprisingly, miR-21 global knock-out mice did not show any overt phenotype when compared with wild type mice with respect to cardiac stress response. Similarly, short (8-nt) oligonucleotides designed to inhibit miR-21 could not inhibit cardiac hypertrophy or fibrosis.[26] In another study with a mouse model of acute myocardial infarction, miR-21 expression was found to be significantly lower in infarcted areas and overexpression of miR-21 in those mice via adenovirus-mediated gene transfer decreased myocardial infarct size.[27] [edit] References
[edit] Further reading
[edit] External links
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stem-loop |
u ccu gu a a a u a guacca ugucgg agcuuauc gacug uguug cugu g a |||||| |||||| |||||||| ||||| ||||| |||| | u uauggu acaguc ucggguag cugac acaac ggua c c c uuu ug - g - - uGet sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Database links |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence cgr-miR-21-5p |
|
| Accession | MIMAT0004417 |
| Previous IDs | cgr-miR-21 |
| Sequence |
18 - uagcuuaucagacugauguuga - 39 |
| Evidence | experimental; cloned [1], Solexa [2] |
Mature sequence cgr-miR-21-3p |
|
| Accession | MIMAT0022937 |
| Sequence |
56 - caacagcagucgaugggcuguc - 77 |
| Evidence | experimental; Solexa [2] |
References |
|
| 1 |
PMID:17570552
"Initial identification of low temperature and culture stage induction of miRNA expression in suspension CHO-K1 cells"
Gammell P, Barron N, Kumar N, Clynes M
J Biotechnol. 130:213-218(2007).
|
| 2 |
PMID:21392545
"Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering"
Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Siederdissen CH, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J
J Biotechnol. 153:62-75(2011).
|
Comments, questions? Email mirbase@manchester.ac.uk