Stem-loop sequence hsa-mir-509-3

AccessionMI0005717 (change log)
Symbol HGNC:MIR509-3
DescriptionHomo sapiens miR-509-3 stem-loop
Gene family MIPF0000130; mir-506
Literature search

32 open access papers mention hsa-mir-509-3
(200 sentences)

Stem-loop
   -- ug    c   - ug        g       --g  u 
5'   g  guac cua c  cagacgug caaucau   ua a
     |  |||| ||| |  |||||||| |||||||   ||  
3'   c  caug gau g  gucugcau guuagua   au a
   ua gu    a   g gu        g       aaa  u 
Get sequence
Deep sequencing
94722 reads, 352 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147259652-147259726 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-509-3
hsa-mir-509-1chrX: 147260532-147260625 [-]
hsa-mir-509-3chrX: 147259652-147259726 [-]
hsa-mir-509-2chrX: 147258760-147258850 [-]
hsa-mir-514bchrX: 147250151-147250230 [-]
Database links

Mature sequence hsa-miR-509-3-5p

Accession MIMAT0004975
Sequence

10 - 

uacugcagacguggcaaucaug

 - 31

Get sequence
Deep sequencing47149 reads, 84 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-509-3p

Accession MIMAT0002881
Previous IDshsa-miR-509
Sequence

44 - 

ugauugguacgucuguggguag

 - 65

Get sequence
Deep sequencing142713 reads, 70 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).