|
miRBase |
|
Stem-loop sequence hsa-mir-509-3 |
||||||||||
| Accession | MI0005717 | |||||||||
| Symbol | HGNC:MIR509-3 | |||||||||
| Description | Homo sapiens miR-509-3 stem-loop | |||||||||
| Gene family | MIPF0000130; mir-506 | |||||||||
| Stem-loop |
-- ug c - ug g --g u g guac cua c cagacgug caaucau ua a | |||| ||| | |||||||| ||||||| || c caug gau g gucugcau guuagua au a ua gu a g gu g aaa u |
|||||||||
| Deep sequencing |
| |||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links | ||||||||||
Mature sequence hsa-miR-509-3-5p |
|
| Accession | MIMAT0004975 |
| Sequence |
10 - uacugcagacguggcaaucaug - 31 |
| Deep sequencing | 30019 reads, 15 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
Mature sequence hsa-miR-509-3p |
|
| Accession | MIMAT0002881 |
| Previous IDs | hsa-miR-509 |
| Sequence |
44 - ugauugguacgucuguggguag - 65 |
| Deep sequencing | 40943 reads, 13 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17573847
"Analysis of gene expression in normal and neoplastic human testis: new roles of RNA"
Int J Androl. 30:316-326(2007).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|