|
miRBase |
|
Stem-loop sequence hsa-mir-924 |
|||||
| Accession | MI0005716 | ||||
| Symbol | HGNC:MIR924 | ||||
| Description | Homo sapiens miR-924 stem-loop | ||||
| Gene family | MIPF0000513; mir-924 | ||||
| Stem-loop |
--aa g ---- u - g uaga ucu ug gaug ucuu c |||| ||| || |||| |||| u aucu aga ac cuac ggga u caac g ucca - c a |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-924 |
|
| Accession | MIMAT0004974 |
| Sequence |
4 - agagucuugugaugucuugc - 23 |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17573847
"Analysis of gene expression in normal and neoplastic human testis: new roles of RNA"
Int J Androl. 30:316-326(2007).
|