Stem-loop sequence hsa-mir-921

AccessionMI0005713 (change log)
Symbol HGNC:MIR921
DescriptionHomo sapiens miR-921 stem-loop
Gene family MIPF0000982; mir-921
Literature search

4 open access papers mention hsa-mir-921
(29 sentences)

Stem-loop
   a       ggga   aa   -     cag 
5'  cuaguga    cag  cca ggauu   a
    |||||||    |||  ||| |||||    
3'  ggucacu    guc  ggu ccugg   c
   -       --ag   cg   a     acu 
Get sequence
Deep sequencing
1045 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 166154743-166154798 [-]
intergenic
Database links

Mature sequence hsa-miR-921

Accession MIMAT0004971
Sequence

2 - 

cuagugagggacagaaccaggauuc

 - 26

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).