Stem-loop sequence ppt-MIR156b

Accession MI0005696
Description Physcomitrella patens miR156b stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
------------------------------------------gugaggcucgagugcagacacuauucaagugugggcggggggagcggga      -                g   c  cu     ag 
                                                                                           gugaca gaagagagugagcacg uug gc  guacg  g
                                                                                           |||||| |||||||||||||||| ||| ||  |||||  a
                                                                                           cgcugu cuucucucacucgugu aac cg  caugc  u
guggugugggaaguggaggggaggaggagggaguguguggggggaggggugggagaguaguguuuacugcaguguugcugcucccucuccg      a                g   u  uu     aa 
Get sequence
Deep sequencing
1838 reads, 3 experiments
Genome context
Coordinates (JGI1.1) Overlapping transcripts
scaffold_167: 958010-958229 [+]
intergenic

Mature sequence ppt-miR156b

Accession MIMAT0004384
Sequence

51 - 

ugacagaagagagugagcac

 - 70

Get sequence
Deep sequencing 1684 reads, 3 experiments
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).