|
miRBase |
|
Stem-loop sequence ppt-MIR477c |
|||||
| Accession | MI0005671 | ||||
| Previous IDs | ppt-MIR473a | ||||
| Description | Physcomitrella patens miR477c stem-loop | ||||
| Gene family | MIPF0000216; MIR477 | ||||
| Stem-loop |
gu a c cu a c uuu ug uuuuuccucu c caaaggcuucca cgu cuu g || |||||||||| | |||||||||||| ||| ||| u ac aaggaggaga g guuucugaaggu gca gaa g -- a a uu c c cga |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence was named miR473a in [1]. The miR477 family contains miRNAs previously called miR473, miR1210 and miR1213 here. The names and sequences are rationalised in [2]. The mature sequence shown here is the most abundant clone by deep-sequencing [2]. |
||||
| Genome context |
|
||||
Mature sequence ppt-miR477c |
|
| Accession | MIMAT0004359 |
| Previous IDs | ppt-miR473a |
| Sequence |
12 - cucucccucaaaggcuucca - 31 |
| Deep sequencing | 8296 reads, 3 experiments |
| Evidence | experimental; Northern [1], 454 [2], cloned [2] |
References |
|
| 1 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
| 2 |
PMID:17601824
"Common functions for diverse small RNAs of land plants"
Plant Cell. 19:1750-1769(2007).
|