|
miRBase |
|
Stem-loop sequence ppt-MIR414 |
|||||
| Accession | MI0005669 | ||||
| Description | Physcomitrella patens miR414 stem-loop | ||||
| Gene family | MIPF0000375; MIR414 | ||||
| Stem-loop |
----------------------------a uuc -acaauua a caaugcuagaauguggggcucaccagauuuuccaacugcauuggcua
gacg aaga gaga gac g
|||| |||| |||| |||
cugc uucu uucu cug c
gacuacgacuccugcuccuacuacuccua --- acuacugc a cuacuacuucuacuguuucuauaccaaugacgguuucgcgaucgucu
|
||||
| Comments |
The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases. |
||||
| Genome context |
|
||||
Mature sequence ppt-miR414 |
|
| Accession | MIMAT0004357 |
| Sequence |
146 - ucauccucaucauccucgucc - 166 |
| Evidence | experimental; Northern [1] |
References |
|
| 1 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
| 2 |
PMID:16669754
"MicroRNAS and their regulatory roles in plants"
Annu Rev Plant Biol. 57:19-53(2006).
|