Stem-loop sequence ppt-MIR156c

AccessionMI0005654
DescriptionPhyscomitrella patens miR156c stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      u   a      -                g  g    u     ag 
5' gag ggg gugaca gaagagagugagcaca uu agca guacg  g
   ||| ||| |||||| |||||||||||||||| || |||| |||||  g
3' cuc ucc cacugu cuucucucacucgugu aa ucgu caugc  u
      -   g      a                g  g    u     ag 
Get sequence
Deep sequencing
1799 reads, 1.21e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.1) Overlapping transcripts
scaffold_3: 2089939-2090033 [+]
intergenic

Mature sequence ppt-miR156c

Accession MIMAT0004346
Sequence

10 - 

ugacagaagagagugagcac

 - 29

Get sequence
Deep sequencing1558 reads, 3 experiments
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).