Stem-loop sequence ghr-MIR399b

AccessionMI0005653 (change log)
DescriptionGossypium hirsutum miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

12 open access papers mention ghr-MIR399b
(33 sentences)

Stem-loop
   uga au     a       a      g    aggcagccauuguauauggcuccguucaucag 
5'    g  auuac gggcaaa ucuuca uggc                                g
      |  ||||| ||||||| |||||| ||||                                c
3'    c  uaaug ccuguuu agaggu accg                                a
   ugg cu     g       -      a    ccucuugugugacguuaaaagguaugucgacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR399b

Accession MIMAT0005821
Sequence

98 - 

cgccaauggagauuuguccgg

 - 118

Get sequence
Evidence by similarity; MI0001020

References

1
PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).