Stem-loop sequence ghr-MIR399a

Accession

MI0005652

Description

Gossypium hirsutum miR399a stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

--uga au     a       a      g    aggcaguauauggcuccauucaucaggca 
     g  auuac gggcaaa ucuuca uggc                             u
     |  ||||| ||||||| |||||| ||||                             c
     c  uaaug ccuguuu agaggu accg                             a
cuugg cu     g       -      a    ccucuugugugacguuaaaagguaugucg 

Mature sequence ghr-miR399a

• Accession: MIMAT0005820
• Sequence: 92 - cgccaauggagauuuguccgg - 112
• Evidence: by similarity; MI0001025

References

1. PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).