Stem-loop sequence ghr-MIR396b

AccessionMI0005651 (change log)
DescriptionGossypium hirsutum miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

17 open access papers mention ghr-MIR396b
(35 sentences)

Stem-loop
   cuuc    uc            c            uuc     a  agaucauucauucauucauug 
5'     guau  uuccacagcuuu uugaacugcaau   augua uc                     u
       ||||  |||||||||||| ||||||||||||   ||||| ||                     c
3'     caua  agggugucgaaa aacuuggcguug   ugcau ag                     g
   caaa    ga            u            --u     g  cauacauacguugugguaguu 
Get sequence
Deep sequencing
24 reads, 1.28e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR396b

Accession MIMAT0005819
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Deep sequencing24 reads, 1 experiments
Evidence by similarity; MI0002326

References

1
PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).