Stem-loop sequence ghr-MIR396a

AccessionMI0005650 (change log)
DescriptionGossypium hirsutum miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

17 open access papers mention ghr-MIR396a
(38 sentences)

Stem-loop
   -cuuc    uc            c            uuc     aucagaucauucauucauucguug 
5'      guau  uuccacagcuuu uugaacugcaau   augua                        u
        ||||  |||||||||||| ||||||||||||   |||||                        c
3'      caua  agggugucgaaa aacuuggcguug   ugcau                        g
   acaaa    ga            u            --u     gagcauauauacgucgugguaguu 
Get sequence
Deep sequencing
25 reads, 6.85e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR396a

Accession MIMAT0005818
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Deep sequencing24 reads, 1 experiments
Evidence by similarity; MI0002326

References

1
PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).